Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for HNF4A_HUMAN
HNF4A_HUMAN
ABS
TFBS logo for HNF4A_HUMAN
HNF4A_HUMAN
ORegAnno
TFBS logo for HNF4A
HNF4A
HNF4
TFBS logo for HNF4A_HUMAN
HNF4A_HUMAN
HNF4A_Mizutani
TFBS logo for HNF4A_MOUSE
HNF4A_MOUSE
ABS
TFBS logo for HNF4A_MOUSE
HNF4A_MOUSE
ORegAnno
Overview

HNF4α binds predominantly direct repeats with a spacing of one nucleotide (DR1). The sequence of the half sites (AGGTCA) is the same as that of the non steroid nuclear receptors (NRs) although typically one of the half sites is more GC rich. The spacer nucleotide is almost always an A. Over 200 unique binding motifs in various target genes have been reported for HNF4α in the literature but HNF4α is predicted to bind thousands of different variations of the DR1 [1][2] (See also the link below to HNF4 Motif Finder). HNF4α can also bind DR2s, although with a lower affinity than DR1s [3].

Many, but not all, DR1 sites to which HNF4α binds are also bound by other nuclear receptors (NRs), such as COUP-TFs, RXR and PPARs. Consequently, HNF4α and the other NRs regulate the expression of many of the same genes. For NRs that tend to repress transcription (e.g., COUP-TFs), competition for the same binding site results in a competition for the control of the promoter [4][5]. Whereas there are a few papers comparing the DNA binding specificity of HNF4α to other NRs [6], a thorough analysis has not been done.

References
  1. Badis G et al. Diversity and complexity in DNA recognition by transcription factors. Science, 324(5935):1720-3. (PMID 19443739)
  2. Ellrott K et al. Identifying transcription factor binding sites through Markov chain optimization. Bioinformatics, 18 Suppl 2:S100-9. (PMID 12385991)
  3. Jiang G and Sladek FM. The DNA binding domain of hepatocyte nuclear factor 4 mediates cooperative, specific binding to DNA and heterodimerization with the retinoid X receptor alpha. J. Biol. Chem., 272(2):1218-25. (PMID 8995424)
  1. Mietus-Snyder M et al. Antagonism between apolipoprotein AI regulatory protein 1, Ear3/COUP-TF, and hepatocyte nuclear factor 4 modulates apolipoprotein CIII gene expression in liver and intestinal cells. Mol. Cell. Biol., 12(4):1708-18. (PMID 1312668)
  2. Ladias JA et al. Transcriptional regulation of human apolipoprotein genes ApoB, ApoCIII, and ApoAII by members of the steroid hormone receptor superfamily HNF-4, ARP-1, EAR-2, and EAR-3. J. Biol. Chem., 267(22):15849-60. (PMID 1639815)
  3. Nakshatri H and Bhat-Nakshatri P. Multiple parameters determine the specificity of transcriptional response by nuclear receptors HNF-4, ARP-1, PPAR, RAR and RXR through common response elements. Nucleic Acids Res., 26(10):2491-9. (PMID 9580705)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Preferred profile
Pazar TFIDSpeciesTF NamePazar Project
TF0000696NoneHNF4AHNF4

LogoPFMSites
140_ENST00000316099_TF0000696.png
 ACGTA
A
  C
C
  G
G
  T
T
152113113
A
C
G
T
2519110
A
C
G
T
32655323
A
C
G
T
48303435
A
C
G
T
5786212
A
C
G
T
694535
A
C
G
T
7814202
A
C
G
T
8931121
A
C
G
T
9421001
A
C
G
T
10815642
A
C
G
T
113351950
A
C
G
T
12487214
A
C
G
T
13729917
A
C
G
T
There are too many sites in this dataset to display. Please visit this project in Pazar to view the sites.
  Sequence Gene TF or TF complex Pazar sequence
 
Other profiles
Pazar TFIDSpeciesTF NamePazar Project
TF0000546NoneHNF4A_HUMANORegAnno

LogoPFMSites
140_ENST00000338692_TF0000546.png
 ACGTA
A
  C
C
  G
G
  T
T
120014
A
C
G
T
201141
A
C
G
T
37090
A
C
G
T
415100
A
C
G
T
501420
A
C
G
T
604012
A
C
G
T
722012
A
C
G
T
821013
A
C
G
T
900124
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 CGGGAGGCGCCCTTTGGACCTTTTG 25
APOB (human)HNF4A_HUMANRS0001823
2 GGGGCGTGGACTTTGCTCCAGC 22
F10 (human)HNF4A_HUMANRS0001880
3 AAGAAGCATGCC 12
G6PC (human)HNF4A_HUMANRS0001885
4 GCCAAAGTTAAT 12
G6PC (human)HNF4A_HUMANRS0001886
5 AGGAGTACGGAAATCGTTC 19
ALDOB (human)HNF4A_HUMANRS0001909
6 CTGTGGACTTAGTTCAAGGCCA 22
CYP7A1 (human)HNF4A_HUMANRS0001965
7 TTGCGGCCACAGGGCAAGGTCCAGGTG 27
CYP8B1 (human)HNF4A_HUMANRS0001987
8 ATGTCCAAAGTCCAAACAT 19
AKR1C4 (human)HNF4A_HUMANRS0001998
9 TCATGTGCAAAGTTGAGTT 19
CYP3A4 (human)HNF4A_HUMANRS0002190
10 CTTTGAACTTAGCTCATAG 19
CYP3A4 (human)HNF4A_HUMANRS0002191
11 TCCCAGCTGGGGCGTGGACTTTGCTCCA 28
F10 (human)HNF4A_HUMANRS0002227
12 CCGCCCCCACTGAACCCTTGACCCCTGCCC 30
T 31
APOA1 (human)HNF4A_HUMANRS0002318
13 CCTTGAACTCTTAAGTTCCACATTGCCAGG 30
ACCAGTGAGCAGCAACAGGGCC 52
APOA1 (human)HNF4A_HUMANRS0002319
14 TAGTCTCAGGGTCACAAAAGTCCAAGAGGC 30
C 31
APOA4 (human)HNF4A_HUMANRS0002324
15 GGAGATGTGGACTTTGCCCCCCATGAGCCC 30
APOA4 (human)HNF4A_HUMANRS0002325
16 GGTCAGCAGGTGACCTTTGCCCAGCG 26
APOC3 (human)HNF4A_HUMANRS0002327
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000353NoneHNF4A_HUMANABS

LogoPFMSites
140_ENST00000338692_TF0000353.png
 ACGTA
A
  C
C
  G
G
  T
T
10400
A
C
G
T
23001
A
C
G
T
32002
A
C
G
T
42020
A
C
G
T
50130
A
C
G
T
60004
A
C
G
T
70004
A
C
G
T
81300
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TGGACTTAGTTC 12
GS0000655 (human)HNF4A_HUMANRS0001093
2 AAGAAGCATGC 11
GS0000662 (human)HNF4A_HUMANRS0001100
3 GCCAAAGTTAA 11
GS0000662 (human)HNF4A_HUMANRS0001101
4 CAAGGTTCATA 11
GS0000688 (human)HNF4A_HUMANRS0001153
 
Pazar TFIDSpeciesTF NamePazar Project
TF0001158NoneHNF4A_HUMANHNF4A_Mizutani

LogoPFMSites
140_ENST00000316673_TF0001158.png
 ACGTA
A
  C
C
  G
G
  T
T
1321222134
A
C
G
T
21661771
A
C
G
T
357291095
A
C
G
T
4111661013
A
C
G
T
5719201
A
C
G
T
64280168
A
C
G
T
745512129
A
C
G
T
8187184
A
C
G
T
91001873
A
C
G
T
1062435144
A
C
G
T
1153873426
A
C
G
T
1214155724
A
C
G
T
131586891
A
C
G
T
1481014051
A
C
G
T
There are too many sites in this dataset to display. Please visit this project in Pazar to view the sites.
  Sequence Gene TF or TF complex Pazar sequence
 
Pazar TFIDSpeciesTF NamePazar Project
TF0001157NoneHNF4A_HUMANHNF4A_stimulated_Mizutani

LogoPFMSites
140_ENST00000316673_TF0001157.png
 ACGTA
A
  C
C
  G
G
  T
T
15642948
A
C
G
T
289176331
A
C
G
T
3251314913
A
C
G
T
438268353
A
C
G
T
525703669
A
C
G
T
61117829
A
C
G
T
7196220
A
C
G
T
812012671
A
C
G
T
91571384
A
C
G
T
10201962
A
C
G
T
1118265115
A
C
G
T
1231093058
A
C
G
T
139167123
A
C
G
T
14133251626
A
C
G
T
There are too many sites in this dataset to display. Please visit this project in Pazar to view the sites.
  Sequence Gene TF or TF complex Pazar sequence
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000589NoneHNF4A_MOUSEORegAnno

LogoPFMSites
140_ENSMUST00000018094_TF0000589.png
 ACGTA
A
  C
C
  G
G
  T
T
13000
A
C
G
T
20030
A
C
G
T
30021
A
C
G
T
41002
A
C
G
T
50300
A
C
G
T
62100
A
C
G
T
72010
A
C
G
T
83000
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 AGTTCCAAGGTCT 13
BAAT (mouse)HNF4A_MOUSERS0002163
2 AGGACAGAGTCCA 13
SLC27A5 (mouse)HNF4A_MOUSERS0002280
3 ATGCTGTACTTTTGACCTC 19
ACMSD (mouse)HNF4A_MOUSERS0002281
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000371NoneHNF4A_MOUSEABS

LogoPFMSites
140_ENSMUST00000018094_TF0000371.png
 ACGTA
A
  C
C
  G
G
  T
T
10200
A
C
G
T
22000
A
C
G
T
32000
A
C
G
T
41010
A
C
G
T
50020
A
C
G
T
60011
A
C
G
T
70002
A
C
G
T
80200
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 CAAGGTTCATA 11
GS0000690 (mouse)HNF4A_MOUSERS0001159
2 TGACCTTTGACT 12
GS0000907 (mouse)HNF4A_MOUSERS0001586
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000279NoneHNF4A_HUMANpleiades genes

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
  Sequence Gene TF or TF complex Pazar sequence
1 TTAGATTGTTCTTTGAGCCCTGCAT 25
LCT (human)NUCLEAR EXTRACTCACO-2, HNF4A_HUMANRS0000930